(Part 1) (Part 2)
I can't tell if people are being funny or not. (bold my emphasis). Most likely not.
(gene names have been changed to protect against potential competitors' googling since it's not my stuff - yeah, it's like that)
-----------------------------------------------------------
From: xxxx xxxx
Date: May 21, 2007 6:46:59 PM GMT+02:00
To: Alex Bird
Subject: mutation
Hey Alex,
so, I got the protocols and so on, thanks a lot for that,
could we seat together once tomorrow desiging primer to change the YFG3wt gene into the YFG3-ITD?
I attach you a word document, with the wt gene and the mutated one, the insertion is in red,
cacgtt gatttcagagaatatgaatatgat
the underlined part 24 bp is the exact duplication.
I'm sure it will be like to eat a piece of cake.
thanks
xxxx
xxxx xxxx
Max Planck Institute Cell Biology & Genetics
PfotenhauerStr.108 01307
Dresden Germany
Red 
Yellow 
Green 
Maroon 
2 comments:
oh no! is this the Antonio i asked you about? the guy with a reputation? I mean, this italian guy who chatted up my friend which led to me having to listen to some exhausting stories about how charming Italians are supposed to be blablablabla ?
Different Italian. No, this one's married with a child.
Post a Comment