Weeeeee are the Champiuuuuuuns my Friiiiieeeennnd.........in Beautiful Chemnitz

Last weekend the MPI-CBG and friends ultimate frisbee team Ring of Fire competed in a tournament in Chemnitz (more on Chemnitz below).

This was our first tournament as a team, and I have to say, we had especially low expectations. Mainly stemming from a combination of the facts that a)we "practice" on a field about half-regulation size b)we are usually out there for fun and don't spend alot of time on rules and strategy and c) we've never actually played all together on a full size team. So to our amazement we went out there and gave a good show. Actually from the beginning we were winning convincingly. Like 6-3, 7-1, 5-2 types of scores. In fact we didn't lose a game and took the championship with a closely fought and dramatic comeback (against another Dresden team) in the last game. Down 2-4 with 5 minutes left, reeled off 3 scores to take it. It was a great sports moment.


Now there were only 8 teams at this tourney. And this clearly wasn't the best Germany had to offer as far as ultimate. But people were traveling from as far away as Munich to participate. And we actually did a very good job as coming together as a team, sticking to our game plans, remaining calm, playing tough defense, and going close to 100% all the time with frequent substitutions.
Our rewards included a couple of bottles of Sekt, which Sanni and Albrecht quickly made good use of at the awards ceremony:

And a small trophy in the shape of the head of Karl Marx:

Which brings me back to Chemnitz. Chemnitz is a city of about 250,000 about 45 minutes southwest of Dresden. I'd never been there before, but heard things about it, all of it bad. As in, basically a crappy place nobody would ever want to go. During East German times Chemnitz was named "Karl-Marx-Stadt" and was basically the quintessential communist DDR city. The trophy above is a replica of a giant stone head in the city:

As you can see, it's freakin' huge (see person at base). If this scene isn't communist, I don't know what is. Unfortunately, Chemnitz hasn't come a long way since reunification. My first impression was that is was a quite green city. Then I realized that was from trees and grass growing up through run down, abandoned buildings. Communist type buildings are everywhere, and most streets and buildings remain in a state of disrepair. Unemployment in Chemnitz is among the highest in Germany, and birth rate is the lowest. There are ongoing plans to restore the city center, but it will be a slow process.

but back to ultimate. Which I will never get used to saying. I don't know what hippie came up with this name, but I still cringe to say we're playing "ultimate frisbee". One nice thing is that it offers a nice chance to practice some sports photography:

These are from our regular Sunday games in the Grosse Garten. More pics are here.
Wow, long post....So I'll leave you with the aftermath of a long Saturday

Bummer.

I almost forgot, I got this message in the bathroom before the G. Love concert.
How depressing. I never knew.

by the way "würg" is like "gag" or "barf".
3.2 megapixel cell phone camera comes through again. Actually there were a suprising number of anti-American notes in this stall. I can't figure out why - a number of American bands play this venue, but why pay 20 euros for a concert if you hate them so much?

June 8th, New York City

So it appears Colby is blowing up. Well, at least he has work in two galleries that are opening shows in the next month. First, some pieces in a show entitled "In Defense of Ardor" at Bellwether Gallery in Chelsea. The piece on the front page there is his.

And then a more prominent show opening June 8th at CRG Gallery . I'm flying in for this one, so if you're gonna be in NYC or around there, holler, and come to the opening. Friday June 8th.

If you've been looking at Colby's website, wondering what this stuff is all about, the press release will give you a clue, although I don't know if Colby actually wrote what went into it about his stuff.

Männertag

Last Thursday was "Männertag" or "Man's day". Actually, technically it was the religious holiday "Christi Himmelfahrt" (Ascension). But at some point here, and apparently it is particularly pronounced in Saxony, it evolved into "Männertag", a day celebrated my grown men by the masses getting drunk off their asses all day long, making fools of themselves in public, and eventually getting into fights and/or arrested. What an embarrassing "holiday" when police are securing the city the night before in anticipation, hoping to avoid, for example, what happened two years ago. (1000-drunks-strong riot a few blocks from my house where 41 police were injured and over 100,000 euros of damage occured).


So of course I celebrated. When in Rome......, right? There's this sweet little courtyard-grill area with my building.

Radeberger and Bratwurst. Really, what else?

Everybody in this picture is a doctor, is working in their PhD, is a CEO, or is named Matt.

After hours of that we headed to the park, where a few of us actually managed to get a bunch of Europeans to play some American football(!). It was hilarious. The Kiwi was actually the star, returning a punt for a TD, yet having trouble remembering which team he was on, or, for that matter, how to walk straight. No doubt the rugby heritage in the blood.

MVP
(used without permission, or even knowledge, of photographer, creative artist, or subject)

Damn.



Olberman's often good for a good ass-kickin'.
Since I don't have American television, I just let The Editors cue up some of this good stuff.

COMMENTS - Don't be Shy

I get several hits everyday on this blog, so I know somebody's out there reading. Don't be shy about leaving comments on the posts, it's the way it's done. And lets me know y'all are sometimes there. Doesn't have to be Shakespeare.

Okay, I just realized it seems you have to have a google or eblogger login to leave comments. but you probably do anyway. And if not it's easy.

Funny Work E-mails, Part 3

(Part 1) (Part 2)
I can't tell if people are being funny or not. (bold my emphasis). Most likely not.
(gene names have been changed to protect against potential competitors' googling since it's not my stuff - yeah, it's like that)

-----------------------------------------------------------
From: xxxx xxxx
Date: May 21, 2007 6:46:59 PM GMT+02:00
To: Alex Bird
Subject: mutation

Hey Alex,

so, I got the protocols and so on, thanks a lot for that,

could we seat together once tomorrow desiging primer to change the YFG3wt gene into the YFG3-ITD?

I attach you a word document, with the wt gene and the mutated one, the insertion is in red,
cacgtt gatttcagagaatatgaatatgat

the underlined part 24 bp is the exact duplication.

I'm sure it will be like to eat a piece of cake.
thanks
xxxx


xxxx xxxx
Max Planck Institute Cell Biology & Genetics
PfotenhauerStr.108 01307
Dresden Germany

An Evening with G. Love and Special Sauce

Wednesday night G. Love and Special Sauce had a show in Dresden. And this was one of the strangest shows I've been to. Mainly because there was nobody there. The evening started when my friend Kat and I showed up about 30 minutes before the announced start time - and we were the ONLY ones in the whole place. So we got a coupla beers and went outside across the street to sit in the grass in the sun. And we're sitting there and this tall lanky guy comes strolling down the neighborhood street with a coke and give us a weird look. And 10 seconds later were like, wait, that was "G. Love." weird.

So eventually we went back into the club, had a few more beers, and very slowly people started coming in. About an hour later we're thinking maybe an opening act will come on soon, but the place is still empty with some people milling around talking and drinking. And then G. Love and Special Sauce walk onto the stage. And there isn't a single person at the stage in the audience. And like 5 people start clapping. And the band has this look like "aww hell, this is gonna be a long night, what the hell." And then the 50 or so people throughout the club gather together near the stage and they just open with "Garbage Man". But it's all so surreal, cause I've never been to a G. Love show, but in my mind they are a pretty big act, I was expecting the place to be decently packed.
So they play about 4 songs, people are getting into it, but it's still eerie. I leaned over to say something to Kat between songs and actually whispered to her for fear that G. Love himself might hear me. It was that quiet. And after these songs he's like, "Well, seems like we got a little intimate show here tonight, so....uh, we're taking requests.....what do you guys wanna hear?"
And like 6 people say songs.
And he leans over to me and says, "wait, what did you say?"
"Cold Beverage"
(to band) "Cold Beverage. Huh, is it time for that yet? Ahh, well, fuck it. Cold Beverage."
And they play it. And another song, then back to requests. "Ok, now what?" And guy kinda sheepishly walks up to the stage and barely audibly says "Well, i was wondering if you could play a song my girlfriend wants to hear."
"OK, what."
"Baby Got Sauce."
And then the play it. Then they play a coupla of new tunes, and take a break. and everybody gets a beer. Then they come back on and he's asking for requests again. Kat requested one, then I requested another.
But the thing about it is they actually still put on a really good show. Like they were still jammin out and gettin into it. At the last song G. Love walked up and shook hands with the 5 of us actually requesting songs, and they left the stage, and I assumed there was no chance they'd play an encore. I mean, if there was ever a situation where a band wasn't going to have an encore, THIS was it. But when the left the stage, every single person of the 50-60 were clapping and hollering. And they came back out and played more songs, took a couple more requests, and really got to jammin some blues stuff. I guess they figured, "hey, maybe only 5-10 people here knew our songs coming in, but damn, they all really like it and enjoyed it."
And the band came out afterwards and chatted with those still there (see pic)
SO it was cool in the end. Maybe I shoulda tried to get them to come out for a beer in Neustadt. But there was NO WAY I was gonna be that guy.


Correction: They opened with "Stepping Stones". Thanks Kat. >:P

Dresden's Summer Music Lineup

Actually pretty impressive for this little city in East Germany. Among others:

Red Hot Chili Peppers
Peter Gabriel
Busta Rhymes
G Love and Special Sauce
Lionel Richie
Interpol
Built to Spill
Wilco
Sparklehorse
Reel Big Fish


Chili Peppers is in an arena-type place and 61 euros.
Peter Gabriel is 70 euros ($95).
So I'll pass on those two.
But tomorrow evening is G Love and Special Sauce, should be cool.

Summer World Tour 2007

• June 8-11 Colby Bird Exhibition Opening @ CRG Gallery

New York City, U.S.A.

• June 16-20 7th International Chromosome Segregation and Aneuploidy Workshop

Nannatali, Finland

• July 1-6 57th Meeting of Nobel Laureates

Lindau, Germany

• July 16-21 7th Annual HFSP Awardees Meeting

Sunshine Coast, Australia

• July 26-30 Great Barrier Reef and Coral Sea Dive Trip aboard 'Spoilsport' liveaboard

Cairns, Australia

• Aug 31-Sept 2 World Beard and Moustache Championships

Brighton, England

...check back for new dates.

Not in our Alps

Last summer the first Brown Bear in 170 years was seen in Bavaria. People freaked out. and then they shot it. And then they put it in a museum. next to another brown bear. That was, yep, you guessed it, shot 170 years ago in Bavaria. To make it all even stranger, this bear was part of a European plan to repopulate the Alps with Brown Bears. I guess Germany didn't get the memo.
And now Bavaria's Environment Minister is hashing out a detailed plan to deal with any more of these brown bears that come across the border.

Moths with spines

You may have seen this story about the kid who had two spiders make a home inside his ear.
In the story the doctor who removed the spiders refers to the experience by saying "It was the only time I ever pulled out an invertebrate." Now, to me, this would suggest he once pulled out a vertebrate, which would seem to me to be a MUCH bigger story. I can't even imagine. But no elaboration. Otherwise, one would think he'd just use the word "animal" or "bug".
Unless he was just trying to look smart, as all doctors should, by using a big word.
But then I found another article with more on the story.

Aside from the time some 15 years ago when he extracted a live moth from a patient’s ear, Irvine said he’s never had such an experience.

“It was the only time I ever pulled out an invertebrate,” he said.

Doh! Not only was he trying to use a big word to look smart, he apparently doesn't even know what it means.

Cinco de Mayo


Gary and Sarah had a little get-together Saturday in celebration of Cinco de Mayo (Which is NOT Mexican Independence day, but rather a celebration of one battle victory over the French. And the French losing to anybody is as good of a reason to celebrate as any, right?)
The party was a vegetarian taco and salsa thing, with a fun twist - Hot Sauce testing/tasting. Gary and Sarah are big fans of hot sauce and so had about 16 kinds, which they put out with chips, then had a piece of paper for each person to note their progress. The goal was to get through all of them, from mildest to hottest. If you made it through, plus took a bite of 4 fresh peppers, including a habanero, you got your name on the wall.








Here's the testing station
and the award peppers












And it was actually pretty tough. The first 14 sauces were fine. They gradually got hotter, but not a problem - I was taking double portions to really identify the taste to record accurately. Then, just when you think this tasting is a cake walk, the last two sauces WHUP yo ass. They were "Mad Dog Inferno", and the legendary "Dave's Insanity Hot Sauce". One tiny drop and you are in pain for 10 minutes, no lie.

Here's Gary in his favorite t-shirt cutting out a pepper for one of his victim - er - guests. We learned that Gary is a bit of a sadist. Laurel here had already finished and was contemplating if it was worth it.

Those last two sauces and then the slice of habenero were putting people in bad ways. I swear at one point people were licking ice cream cartons and drinking sour cream in search of relief from the searing searing pain. But Gary and Sarah got their payback. Their toilet stopped working. And hot sauce and hot pepper tex-mex night with people throwing back Coronas to soothe the pain is not a good night for the toilet to go down. Cause it sure didn't stop people from using it.

This Could be Interesting

Well, not "interesting", but entertaining in a curiosity way. But most likely frustrating and ridiculous. "Does God Exist?: Christians vs. Athiests" on ABC. It's more like tune in to see who makes a bigger jackass out of themselves.

In "The Athiests" corner we have a couple who setup the "Blasphemy Challenge", where people just upload YouTube clips of themselves denying the existence of God, etc. How profound. Although I will say they were able to get themselves onto "Nightline" through it all. Most likely they are just looking for the notoriety through the shock value that some will inevitably give it.

In "The Christians" corner we have these doobs Ray Comfort (Is that his real name? Sounds straight out of a cheesy romance novel) and none other than the dreamy Kirk Cameron. These two will forever live in my mind for their elegant disproof of evolution using a banana in a terribly phallic sequence that Kirk even seems to be uncomfortable with. Watch it HERE, it is really really really great viewing.
Yes, it's on GodTube, and that's a whole 'nother post to itself.
Go from 2:20 to about 4:30. You won't be disappointed.

But back to the point. Why would ABC and Nightline air some crap where somebody actually thinks they can "prove" the existence of God in a TV segment and somebody else is willing to debate it with them. Surely there are no viewers that are tuning in for guidance on the issue. I suppose it's mostly people looking to see if "their side" comes out looking the best when it's over. As if it makes any difference to what you believe, these tools on the boob tube.

Zis iz ze German Coastguard

NBA Playoffs

Last night I watched Utah vs. Houston game 5 in Chinese. I take what I can get.

My week

Last week was jam-packed with travel and science talk. I think a preview of the summer to come. On Wednesday we had the first-ever MPI-CBG Postdoc Retreat. 25 postdocs from the institute traveled to a little resort near the Czech border to get to know each other, each other's science, and maybe have a little fun.
It was cool. We all gave short talks with short discussions. Maybe the format was too short, but the idea was mostly to get an idea of what problems people were working on. The "resort" was situated in the Osterzgebirge, a region of hills/mountains South of Dresden. The Erzgebirge are famous for the woodwork handicraft from the region, most notably the Christmas-time decorations (The candle-powered merry-go-round dealy-o's and the little smoking incense men) We ate in a room filled with this stuff. It would have been a really cozy lodge in the winter.
Four of us needed to be in Heidelberg at 9am the next day for a conference. So we rented a car to drive back to Dresden after the first day and catch a 6am flight to Frankfurt and taxi to Heidelberg. Well, we left around 1 in the morning and cruised into Dresden around 2 I think. In our tiredness we decided the best idea would be to sleep in the car at a gas station near the airport so we could just wake up there at 4:30 to catch our flight. Needless to say I couldn't sleep. But we did make it into the conference just as the 1st lecture started at 9:30. And proceeded to stay up for lectures until 6pm, and then to dinner, and out again to the bars for drinks. And then up at 8 the next morning to do it again.
And then more full days of talks for TWO MORE days at a different conference in Heidelberg.

But it was cool. The first conference, for "Mito-check" was great and inspiring as usual. And Heidelberg is a cool town. Kinda the stereotypical fun German town. beautiful. With typical architecture and houses complete with a river through the middle and a giant castle overlooking the valley of it all.

Some observations of the media and the VT shooting

I was in lab the day the shootings happened, and, as usual, checking my yahoo email every couple hours by refreshing my home page. The email page always has a list of headlines of the day, that sometimes I glance at. but just short one-liners. So I first saw this (click to enlarge):

It's interesting, because we are so used to the media telling us how important a news story is, based on the size and typeface of the headline for a particular story. And how big of a picture accompanies it. How many red BREAKING NEWS banners are flashing at us. So I scan these headlines, then think, "Wait. Oh Shit. This is bad. This is huge." Yet this tiny little headline.
Then I go to CNN and there of course is the big headline

I wonder if we got all our news in the exact same format if the most-talked about stories would all still be the same, or if it would force people to think about what IS most important. i.e. not Anna Nicole Smith's baby's paternity test.

What is also interesting is to take a look at the next-day headlines in newspapers around the country and world. There is a very cool site called Newseum that everyday displays the front page of 500+ newspapers from around the world with a high-quality PDF link, and also archives the frontpages of important days in history.

I found a newspaper from Roanoke, the closest big city to V Tech.

Something disturbed me about the presentation here. It was at the top. The "Virginia Tech Shootings: A 12-Page Section". Like they are in competition with the other Roanoke newspaper and need to advertise they have the full-color best special edition coverage of this tragedy for your entertainment. What's more, is it looks strikingly to me like the headline you see on game day. Like they just used the same font and style they did last fall "Virginia-Tech Football vs. UVA: The Rivalry: Special 12 page edition." It even appears to be in V Tech colors.

In Taiwan there was this front page:

Also a bit disturbing, with the cartoon gunman at the bottom and the splashes of blood, one indicating how many victims.

Interestingly, a number of the newspapers from foreign countries did not even mention the shootings from what I could tell at all on the front page.